Version Compatibility
Reference examples tested with: CRISPResso2 2.2+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python:
pip show <package>thenhelp(module.function)to check signatures - CLI:
<tool> --versionthen<tool> --helpto confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
CRISPResso2 Editing Analysis
"Quantify CRISPR editing from my amplicon data" → Analyze amplicon sequencing to measure indel frequencies, HDR efficiency, and frameshift rates from CRISPR gene editing experiments.
- CLI:
CRISPResso --fastq_r1 reads.fq --amplicon_seq ATGC --guide_seq GUIDE
Basic Analysis
Goal: Quantify CRISPR editing outcomes from amplicon sequencing of a single target site.
Approach: Align amplicon reads against the reference and guide sequences with CRISPResso, which reports indel frequencies, allele tables, and editing efficiency plots.
bash# Analyze single amplicon CRISPResso \ --fastq_r1 sample_R1.fastq.gz \ --fastq_r2 sample_R2.fastq.gz \ --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT \ --guide_seq CTGCCCACAGGTGAGGAGGT \ --output_folder crispresso_output \ --name sample1 # Output includes: # - Editing efficiency statistics # - Indel distribution # - Allele frequency plots
With HDR Template
bash# Analyze HDR editing CRISPResso \ --fastq_r1 hdr_sample_R1.fastq.gz \ --fastq_r2 hdr_sample_R2.fastq.gz \ --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT \ --guide_seq CTGCCCACAGGTGAGGAGGT \ --expected_hdr_amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGATGCTCGGCTGTGGTT \ --output_folder hdr_output \ --name hdr_sample
Batch Analysis
Goal: Process multiple CRISPR editing samples in a single run.
Approach: Define a batch file listing sample names, FASTQ paths, amplicon sequences, and guide sequences, then run CRISPRessoBatch for parallel multi-sample analysis.
bash# Create batch file (tab-separated) # batch.txt: # name fastq_r1 fastq_r2 amplicon_seq guide_seq # sample1 s1_R1.fq.gz s1_R2.fq.gz AMPLICON1 GUIDE1 # sample2 s2_R1.fq.gz s2_R2.fq.gz AMPLICON2 GUIDE2 CRISPRessoBatch \ --batch_settings batch.txt \ --output_folder batch_output \ --n_processes 8
Pool Analysis (Multiple Guides)
bash# Analyze pooled amplicons CRISPRessoPooled \ --fastq_r1 pooled_R1.fastq.gz \ --fastq_r2 pooled_R2.fastq.gz \ --amplicon_file amplicons.txt \ --output_folder pooled_output \ --n_processes 8 # amplicons.txt format: # amplicon_name amplicon_seq guide_seq
WGS Analysis
bash# Analyze off-target editing from WGS CRISPRessoWGS \ --bam aligned.bam \ --reference genome.fa \ --regions_file targets.bed \ --output_folder wgs_output
Parse Results in Python
Goal: Extract editing metrics from CRISPResso output for downstream analysis or reporting.
Approach: Load the mapping statistics and quantification files from the CRISPResso output directory, and parse the compressed allele frequency table for allele-level detail.
pythonimport pandas as pd import json # Load mapping statistics with open('crispresso_output/CRISPResso_mapping_statistics.txt') as f: stats = {} for line in f: key, value = line.strip().split('\t') stats[key] = value print(f"Reads aligned: {stats['READS_ALIGNED']}") print(f"Reads aligned %: {stats['READS_ALIGNED_PERCENTAGE']}") # Load quantification quant = pd.read_csv('crispresso_output/CRISPResso_quantification_of_editing_frequency.txt', sep='\t') print(quant) # Load allele frequency alleles = pd.read_csv('crispresso_output/Alleles_frequency_table.zip', compression='zip', sep='\t') print(f"Unique alleles: {len(alleles)}") print(alleles.head(10))
Key Output Files
CRISPResso_output/ ├── CRISPResso_mapping_statistics.txt # Read mapping stats ├── CRISPResso_quantification_of_editing_frequency.txt # Summary ├── Alleles_frequency_table.zip # All allele sequences ├── CRISPResso_RUNNING_LOG.txt # Analysis log ├── Indel_histogram.png # Indel size distribution ├── Insertion_deletion_substitution.png # Edit type pie chart ├── Alleles_frequency_table.png # Top allele bar plot └── CRISPResso2_info.json # Machine-readable summary
Quantify Specific Outcomes
bash# Define expected outcomes CRISPResso \ --fastq_r1 sample_R1.fastq.gz \ --amplicon_seq AMPLICON \ --guide_seq GUIDE \ --coding_seq CODING_REGION \ --quantification_window_size 5 \ --quantification_window_center -3 \ --output_folder output
Base Editing Analysis
bash# For base editors (CBE/ABE) CRISPResso \ --fastq_r1 base_edit_R1.fastq.gz \ --amplicon_seq AMPLICON \ --guide_seq GUIDE \ --base_editor_output \ --conversion_nuc_from C \ --conversion_nuc_to T \ --output_folder base_edit_output
Prime Editing Analysis
bash# For prime editing CRISPResso \ --fastq_r1 prime_edit_R1.fastq.gz \ --amplicon_seq AMPLICON \ --guide_seq GUIDE \ --prime_editing_pegRNA_spacer_seq SPACER \ --prime_editing_pegRNA_extension_seq EXTENSION \ --prime_editing_pegRNA_scaffold_seq SCAFFOLD \ --output_folder prime_edit_output
Compare Samples
bash# Compare two CRISPResso runs CRISPRessoCompare \ --crispresso_output_folder_1 sample1_output \ --crispresso_output_folder_2 sample2_output \ --output_folder comparison_output
Related Skills
- screen-qc - QC for editing experiments
- read-alignment/bwa-alignment - Align reads for WGS analysis
- variant-calling/variant-calling - Detect editing-induced variants
